Tag: sed

bash для замены коротких имен сервера в файле с помощью fqdn

У меня довольно большой файл конфигурации с короткими именами сервера в нем: [host 1] host = server1 [host 2] host = server2 [host 3] host = server3 Мне нужно заменить все короткие имена серверов длинными именами fq, которые будут выводиться из сценария bash, который я уже написал, lookup.sh. Могу ли я использовать магию sed или […]

Я хочу найти строку и вытащить все строки между двумя шаблонами

Я хочу искать строку и вытягивать все линии между двумя шаблонами (включая шаблон). START # 1 Имя S 101 Frankfurt_1_1 19 A + улица КОНЕЦ START # 2 Имя B 104 Берлин 20 A + улица КОНЕЦ START # 100 Имя C 107 Берлин 21 A + улица КОНЕЦ START # 24 Имя D 110 […]

Удаление новых символов линии вокруг шаблонов

У меня есть файл fasta миллионов парных последовательностей, который выглядит так: >7001289F:56:HKH3FBCXX:2:1101:1692:2074 1:N:0:CGATGT GAGCAGAGGCACCGCTGAGCAGACAGCGAGCGAGTGAAGGGGTCAGGGGCCAGTCAGCAATCTCGTGTAGAAAGAATCACGGTCGAGCGGTGCACGCATG >NNNNN GACACCTTCATTTCCACTTTATTGAGCAGCGGCGCATGCGTGCACCGCTCGACCGTGATTCTTTCTACACGAGATTGCTGACTGGCCCCTGACCCCTTCA >7001289F:56:HKH3FBCXX:2:1101:1522:2186 1:N:0:CGATGT GTAGATGATGAATACAGCTGTTGCTGCAGCAACTGGTGCTGAGTAAGCAACTGCGATCCATGGACGCATACCTAAACGGAAAGATAATTCCCAC >NNNNN GTGGGAATTATCTTTCCGTTTAGGTATGCGTCCATGGATCGCAGTTGCTTACTCAGCACCAGTTGCTGCAGCAACAGCTGTATTCATCATCTAC Мне нужно отформатировать его, как показано ниже: >7001289F:56:HKH3FBCXX:2:1101:1692:2074 1:N:0:CGATGT GAGCAGAGGCACCGCTGAGCAGACAGCGAGCGAGTGAAGGGGTCAGGGGCCAGTCAGCAATCTCGTGTAGAAAGAATCACGGTCGAGCGGTGCACGCATGNNNNNGACACCTTCATTTCCACTTTATTGAGCAGCGGCGCATGCGTGCACCGCTCGACCGTGATTCTTTCTACACGAGATTGCTGACTGGCCCCTGACCCCTTCA >7001289F:56:HKH3FBCXX:2:1101:1522:2186 1:N:0:CGATGT GTAGATGATGAATACAGCTGTTGCTGCAGCAACTGGTGCTGAGTAAGCAACTGCGATCCATGGACGCATACCTAAACGGAAAGATAATTCCCACNNNNNGTGGGAATTATCTTTCCGTTTAGGTATGCGTCCATGGATCGCAGTTGCTTACTCAGCACCAGTTGCTGCAGCAACAGCTGTATTCATCATCTAC В основном сложные заголовки представляют собой форвардные считывания последовательности ДНК, и заголовок сразу же представляет соответствующее обратное считывание с заголовками NNNNN. […]

Удалите n-ю строку из сопоставленной строки (которая встречается только один раз в файле)

У меня есть вопрос, связанный с удалением строк, которые появляются в позиции n+2 после согласованной строки, которая находится в позиции n используя awk для нескольких файлов. Я могу напечатать его с помощью команды: awk -F '/radius-server/{nr[NR+4]}; NR in nr' * Где согласованная строка – radius-server . Поскольку я не слишком хорошо знаком с awk я […]

Использование sed для замены строки, содержащей целые переменные

У меня есть текстовый файл и вы хотите использовать sed для замены следующей строки (включая «s»): " rel="lightbox[1846]" title=" с # Числа между [ и ] изменяются и изменяются. Я хочу включить " в замещение». Я читал на подменю и думал . поможет в некотором роде – отличается от * подстановочных знаков, к которым я […]

sed + обновить 4 разных IP-адреса в файле hosts в одной команде sed

как запустить команду sed sed в одной командной строке? sed -i s'/12.1.0.11/#12.1.0.11/g' /etc/hosts sed -i s'/12.1.0.12/#12.1.0.12/g' /etc/hosts sed -i s'/12.1.0.21/#12.1.0.21/g' /etc/hosts sed -i s'/12.1.0.22/#12.1.0.22/g' /etc/hosts моей целью является обновление целевого файла хоста VIA ssh Я не хочу запускать ssh 4 раза! пример ssh linux1 sed -i s'/12.1.0.11/#12.1.0.11/g' …………….. /etc/hosts

Сравнить и объединить конфигурационный файл в CentOS

Я пытался настроить авто-обновление (для нескольких серверов) bash-скрипта через cron для файла конфигурации (на основе текста), загружая новый файл каждый день и заменяя его напрямую. Скрипт работает отлично, однако есть случай, когда иногда каждому серверу нужно будет иметь определенные настройки, отличные от основного файла конфигурации, например, одна из стандартной строки конфигурации будет: port_defined=1,2,3 в то […]

Использование sed из оболочки андроида

Я знаком с sed на эмуляции терминала Android: версия, в которой я использую sed включенную в игрушечную коробку, установленную на моем устройстве, не поддерживаемом устройством Sony. sed –version (или toybox sed –version) дает тот же результат: Это не GNU sed 9.00 Теперь я прочитал конкретное руководство от toybox sed и попробовал несколько простых лайнеров (идея […]

Замена параметров mysql с помощью sed

Я создаю резервный веб-сервер, но я хочу, чтобы на сервере резервного копирования был только один пользователь root. Поэтому после перемещения всех баз данных мне нужно заменить все mysqli_connect(…) в db.txt . Я написал: beg="mysqli_connect(" end=");" #need to find out the database db="123" new="'localhost','root','pass','$db'" cat db.txt | sed "s/$beg.*$end/$beg$new$end/" для замены всех конфигов, но мне нужно […]

Замена переменной, содержащей \ with sed

Я пытаюсь заменить $old string на $new string в файле, где: old=ESX_10.1.1.1\@11.11.11.11 new=host_15_11_0_111.static Я использую команду sed: sed i "s/${old}/${new}/g" /filename но он не заменяет слово, а также не показывает никаких ошибок. Я пробовал это разными способами, например, заменяя: sed i "s,${old},${new},g" /filename а также sed i "s=${old}=${new}=g" /filename Но это не работает. Помогите мне […]

Interesting Posts

Получение двух совпадений из повторяющегося шаблона

Как установить системное соединение через прокси-сервер

Как изменить размер шрифта при использовании lp в Linux?

btrfs на двух физических дисках: md raid 10 или btrfs raid 1

Как сжать все файлы из нескольких подпапок?

X11 / Xlib.h: нет такого файла или каталога

Как удалить пробелы из выбранных строк

Запретить yum проверять наличие обновлений при установке нового пакета

Bash зафиксировать любую ошибку, например -e, но не выходить, сделать что-то еще

Как увеличить размер / dev / sda2 в suse, запущенном на vmware

Запуск su требует пароля несколько раз.

Перемещение / загрузка на новый раздел создает: файл '/boot/grub/i386-pc/normal.mod' не найден

Где настройка отправки электронной почты пользователю системы с помощью ssmtp?

Контролировать, что отправляется в / dev / null?

Проблема Кернинга при использовании шрифта переменной ширины в терминале Debian

Linux и Unix - лучшая ОС в мире.