Articles of grep

grep + поиск рекурсивного сложного синтаксиса в папке в файлах / скриптах

Мы хотим найти следующую рекурсивную строку в папке / s awk ‘{print}’|grep -i -e ‘port is up’ -e ‘valid output’ Итак, мы сделали это: grep -r “awk ‘{print}’|grep -i -e ‘port is up’ -e ‘valid output'” /var grep -r “awk ‘{print}’|grep -i -e ‘port is up’ -e ‘valid output'” /etc grep -r “awk ‘{print}’|grep -i […]

считая совпадающие линии

У меня есть 2 входных файла. Входной файл1 выглядит так Equus caballus Monodelphis domestica Saccharomyces cerevisiae S288c Input2 выглядит следующим образом (показаны первые 10 строк) >CM000377.2/60448635-60448529 Equus caballus chromosome 1, whole genome shotgun sequence. ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTATTCTTATCAGTTTAAAACTAGTGGTGAAATGAGATGTAGACAGTAACATTTGAATTACAACATCA >CM000377.2/105043590-105043453 Equus caballus chromosome 1, whole genome shotgun sequence. ATTGCTTCTTGGCCTTTTGGCTAAGATCAAGTATAGTATCTGTTCTCATCAATTTAAAAATGGCAATATAAATAGACCCATAGTAGATCCAGATAATGGTGTTATCAGAAAAGGACTTTAAGTAATTTAATATGTTCA >CM000377.2/137942042-137941941 Equus caballus chromosome 1, whole genome shotgun sequence. ATCGCTTCTCAGACTTTTGGCTAAGATCAAGCGTAGTATCTGTTCTTATCAGTAATTAACTTCAGAAAAGTTAACTCATCTTCAGCAAGGCAGTAATCCCCT […]

как удалить повторяющийся номер из строки?

Входной файл 1 2 3 1 4 5 6 1 1 2 34 5 6 2 Я хочу вывод, как это 1 2 3 4 5 6 34 (все дубликаты должны печататься только один раз)

Использование grep, чтобы найти строку не в другой строке

У меня есть один текстовый файл. Это экзамен с несколькими вариантами ответов. В нем несколько сотен вопросов, каждый с четырьмя вариантами ответов, по одному в строке, которые начинаются с ABCD После каждого А. (и Б. и т. Д.) Должен быть один пробел, а затем сразу первый символ вопроса. Как это: ++++++++++++++++++++++++++++++++ This is my question […]

Использование grep для определения неправильных заголовков

У меня есть несколько сотен документов, где каждый заголовок имеет вид: # Some title here {.WORD} Я хочу идентифицировать с помощью grep каждый заголовок, который не соответствует этому стандарту. Однако строки, начинающиеся только с #, не должны обнаруживаться. ## | OK # Lorem .tip} | NOT OK # LIPSUM {.tip | NOT OK ### Lipsum […]

Факторинг grep из grep | Sed Stream или писать grep в Sed?

У меня есть файл как: file.foo file2.foo file.bar file3.foo Теперь я хочу вернуть только те строки, которые заканчиваются на .foo , но я хочу переименовать все вхождения file с помощью blag . В этом случае это означает, что file.bar полностью пропустите file.bar . Как мне сделать это с помощью только sed ? По сути то, […]

Что происходит за кулисами, чтобы сделать `grep -R pattern` допустимой командой, когда` grep pattern` нет?

Я заметил, что когда я не указываю список файлов для поиска по grep , grep намного медленнее, чем при указании имен файлов (даже если список равен * , то есть все файлы в каталоге). Похоже, этого не происходит при использовании параметров grep -R pattern работает так же быстро, как grep -R pattern * ). Я […]

строки grep, которые существуют в одном файле, но отсутствуют в другом

Я пытаюсь сделать простые grep и grep -v чтобы получить строки из a.txt который существует в b.txt а не в c.txt . Пример 3 файлов a.txt : a b c d e up.txt : a.up b.up c.up dw.txt : a.dw b.dw Желаемый вывод: c Я написал приведенный ниже код, но grep смотрит на $(sed…) как […]

pcregrep, чтобы найти линии с окружающим пробелом

У меня есть несколько заголовков, начинающихся с # (поскольку они являются уценкой), и у меня есть два следующих правила: заголовки ( # ) должны иметь ровно две строки новой строки вверху и одну снизу субтитры ( ## , ### и т. д.) должны иметь ровно одну пустую строку выше и одну ниже. Заголовки должны иметь […]

сравнить первый столбец 2 файла: в то время как второй имеет 2 столбца, но первый имеет один столбец

у меня есть 2 файла: файл 1: abc mno pqd файл 2: ump 10 abc 12 sfg 30 klp 45 mno 21 pqd 32 jkl 98 lkg 45 Я хочу вывод, как это: abc 12 mno 21 pqd 32