Tag: awk

Unix awk decimal экспорт в трубу

Я пытаюсь адаптировать скрипт, который проходит через большое количество отдельных файлов (subj_id) и выводит значение 4 $ в указанной строке. Текстовый файл содержит строки # Measure Brain, ICV, Brain Volume, 1118718.609121, mm^3 Мой скрипт содержит эту строку для экспорта номера 1118718: printf "%g," `cat ${subj_id}/stats/aseg.stats | grep ICV | awk -F, '{print $4}'` > BrainVol.csv […]

вырезать диапазон столбцов sed / awk / cat

Я хотел бы несколько раз вырезать определенный диапазон текста (например, символы 17-63) из файла *.txt длиной несколько тысяч строк. Одна строка выглядит так: <script>addRow("monatswerte_RR_00002_19140101_20061231_hist.zip","monatswerte_RR_00002_19140101_20061231_hist.zip",0,"12.3 kB","8/11/15, 5:18:00 PM");</script> Кто-нибудь может предложить: я. Вырезать этот диапазон текста? II. Добавить его в другую общую строку? Обновлено: awk -F\" '{print $2}' all-files.txt > output.txt Дает мне .txt файл с […]

Изменить строку, если оригинал не соответствует определенной строке.

У меня есть файл с миллионами строк и вы хотите изменить значения в столбце A, только если строка «.». Модификацией было бы добавить "chr:"$2":"$3 к началу строки. Все остальные строки будут напечатаны как оригинальная версия. Пример ввода: ABCDEFGH rs125 2 5433 T TACA A 3 2 chr2:4543 2 4543 IR 8 2 rs123 3 4332 […]

Как удалить строку, если разница между двумя столбцами меньше 2000

У меня есть набор данных, который выглядит следующим образом: chr1 HAVANA gene 69091 70008 . + . gene_id "ENSG00000186092.4"; transcript_id "ENSG00000186092.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5"; level 2; havana_gene "OTTHUMG00000001094.1"; chr1 ENSEMBL gene 134901 139379 . – . gene_id "ENSG00000237683.5"; transcript_id "ENSG00000237683.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; […]

ошибка в awk / sed использование манипуляций с файлами по очереди

У меня есть требование добавить строку " 1" в конце каждой строки файла. После выполнения ниже двух команд создается пустой файл. awk '{ print $0 " 1" }' < file.txt > file.txt использование sed sed 's/$/ 1/' file.txt > file.txt Какая ошибка была предпринята здесь, можете ли вы посоветуете? Я выполняю эти команды в терминале […]

Объединение столбцов в 2 файла и печать значений, которые различаются

У меня есть файл (файл-1), который выглядит так, DIP-10097N|refseq:NP_416170|uniprotkb:P30015 DIP-10117N|refseq:NP_414973|uniprotkb:P08177 DIP-10168N|refseq:NP_418766|uniprotkb:P15005 DIP-10199N|refseq:NP_415632|uniprotkb:P30958 DIP-10358N|refseq:NP_418659|uniprotkb:P28903 DIP-10440N|refseq:NP_289596|uniprotkb:P20082 DIP-10441N|refseq:NP_417502|uniprotkb:P20083 DIP-10441N|refseq:NP_417502|uniprotkb:P20083 DIP-10467N|refseq:NP_415423|uniprotkb:P09373 DIP-10469N|refseq:NP_418386|uniprotkb:P32674 DIP-10562N|refseq:NP_418370|uniprotkb:P17888 DIP-10582N|refseq:NP_414864|uniprotkb:P77743 DIP-10592N|refseq:NP_415819|uniprotkb:P37344 и другой (файл-2), который выглядит так, DIP-10331N|refseq:NP_311078|uniprotkb:P12638 DIP-10117N|refseq:NP_414973|uniprotkb:P08177 DIP-10331N|refseq:NP_311078|uniprotkb:P12638 DIP-10840N|refseq:NP_414640|uniprotkb:P10408 DIP-1025N|refseq:NP_414574|uniprotkb:P00968 DIP-10097N|refseq:NP_416170|uniprotkb:P30015 DIP-10467N|refseq:NP_415423|uniprotkb:P09373 DIP-10097N|refseq:NP_416170|uniprotkb:P30015 DIP-10117N|refseq:NP_414973|uniprotkb:P08177 DIP-10117N|refseq:NP_414973|uniprotkb:P08177 DIP-10117N|refseq:NP_414973|uniprotkb:P08177 DIP-10750N|refseq:NP_289799|uniprotkb:P02410 DIP-10117N|refseq:NP_414973|uniprotkb:P08177 DIP-10757N|refseq:NP_288150|uniprotkb:P02421 На выходе я хочу напечатать содержимое файла-1 плюс значение в любом столбце файла-2, которое […]

Имитировать команду sed read с awk

Я хочу стимулировать использование sed : sed '3r awk.scr' awk.script с awk.scr : a b cdef и awk.script : hello there is hello i'am there is hello sdfdf dfdfdf aads 23213 3 434 Использование awk здесь: awk 'BEGIN {while((getline gf < "awk.script") > 0) {print gf; if(++i > 2) break;} {while((getline bf < "awk.scr")> 0 […]

С awk, как вставлять число только для строк, начинающихся с «Toto», когда они находятся между определенной парой шаблонов

С awk я хотел бы вставить нумерацию, такую ​​как Record n°i# перед каждой строкой, начинающейся с Toto только когда они расположены между двумя конкретными шаблонами start=ABCD и stop=EFGH . Входной файл: ( Blabla может быть чем-то реальным) Blabla Toto Blabla Blabla Toto Toto Blabla ABCD Toto Blabla Toto Blabla Blabla Toto Blabla EFGH Toto Blabla […]

Измените значения параметра из файла и сгенерируйте файлы параметров из него

Существует файл, содержащий таблицу с именами параметров в качестве первой строки, значения в следующих строках: Как выполнить следующее с помощью awk , sed или любой утилиты сценариев оболочки: fileXX конфигурационный файл с именем fileXX для каждой строки, переносить значения каждого столбца строки в строки (строки) в каждом сгенерированном файле конфигурации, в каждом файле конкатенация первой […]

awk-манипуляция файлом fasta

У меня есть такой файл >chr1 ACGTGGC TGCCGTT ATCCTTG >chr2 ACTTTTA CTCATAA Я хочу преобразовать seq в 1 строку. Это должно быть выход: >chr1 ACGTGGCTGCCGTTATCCTTG >chr2 ACTTTTACTCATAA Как я могу это сделать с помощью awk. Я знаю, как это сделать в Perl. благодаря

Linux и Unix - лучшая ОС в мире.