Tag: awk

Моя awk-программа для изменения пробелов в вкладках не работает

Как написать сценарий оболочки, который использует awk для чтения в файле данных students.txt и выводит данные в формате с вкладками, как показано: Surname Forename MSc Stream Date of Birth Smith John IT 15.01.1986 Taylor Susan IT 04.05.1987 Thomas Steve MIT 19.04.1986 Не беспокойтесь, если столбцы с вкладками не совпадают. Расстояние между каждым столбцом (Фамилия, имя […]

Изменение текста на одном номере строки в нескольких текстовых файлах

Предположим, что у меня есть десять скриптов оболочки bash: script1.sh , script2.sh , …, script10.sh . Первоначально все десять файлов идентичны. Теперь я хотел бы сделать два изменения в каждом скрипте: В каждом файле я хотел бы изменить определенную строку (например, строку 8), то есть удалить все, что находится в строке 8, и заменить его […]

Печать статистики текстового файла

У меня есть текстовый файл (events.dat), как показано ниже (обратите внимание, что показан только экстракт) RepID12 01/01/2010 20:56:00 S10 RepID12 01/01/2010 20:56:00 S03 RepID20 01/01/2010 20:56:00 S17 RepID33 01/01/2010 20:56:00 S02 RepID33 01/01/2010 20:56:00 S18 RepID38 01/01/2010 20:56:00 S11 RepID39 01/01/2010 20:56:00 S20 RepID26 02/01/2010 01:39:00 S20 RepID29 02/01/2010 01:39:00 S16 RepID29 02/01/2010 01:39:00 S03 […]

Как узнать общие элементы между двумя файлами?

Например, у меня есть 2 файла со следующей информацией: Файл №1: 12 13 14 15 Файл №2: 12 1 13 2 14 2 15 6 16 7 17 8 Выходной файл: 1 2 2 6 В выходном файле мне нужны только значения второго столбца файла # 2, которые совпадали с первым столбцом файла # 1. […]

Сравните два текстовых файла и найдите соответствующие строки

У меня есть два файла A и B. A выглядит так (от 4 до 6 строк): GAGA CAGA GGGT TATT файл B – действительно большой файл с тысячами строк, вот краткий пример: AAATGTCAAGAGACAGAAATGTCAAGAGGGT AAGGGGGTTTATAATCATAAATCAAAGAAAT ATATACAGAAATGTCAAGAGACAGAAATGTC TCAAGAGACAGAAATGTCAAGAGGGTCTATA AAGAGGGTCTATAATCATAAATCAAAGAAAT AAGAGGGTCTATAATCATAAATCAAAGAAAT ATACAGAAATGTCAAAACAGAAATGTCAAGG ATATACAGAATATACAGAAATGTCAAGTTAT ACAGAATATACAGAAATGTCAAGTTATATAC ATATACAGAAATGTCAAGAGACAGAAATGTC TCAGAATATAGTATTCTATTATATACAGAAA AATATAGTATTCTATTATATACAGAAATGTC GAATATACAGAAATGTCAAGTTATATACAGA TATACAGAATATAGTATTCTATTATATACAG CAGAATATAGTATTCTATTATATACAGAATA AGTTATATACAGAATATAGTATTCTATTATA TACAGAATATAGTATTCTATTATATACAGAA CAGAAATGTCAAGTTATATACAGAATATAGT Мне нужно искать каждую строку […]

Системные вызовы, AWK и ввод внешних входов

awk '{ TEMPVAR="/usr/bin"; printf("%s", system("ls $TEMPVAR")); }' empty В этом примере я пытаюсь ввести переменную TEMPVAR в system вызов. Как мне это сделать? То, что я собираюсь сделать: я пытаюсь использовать date -d $0 +%s в system вызове, который встречается в каждой строке файла. Тем не менее, я борюсь с тем, как получить значение $0 […]

Использование Grep -o или Sed / Awk для захвата фрагмента из середины строки

Я наблюдаю за журнальным трафиком и вижу регулярное злоупотребление различными поисковыми системами изображений, особенно Bing. Пример URL: http://www.bing.com/images/search?q=dagger+genesis+solo&view=detailv2&&&id=C65E811DFE01FB11258D2EB4F516F3DD8F09049C&selectedIndex=4&ccid=ffC0NVO8&simid=608046582336849763&thid=JN.XnLfF7qiZGwjJzTCR6f7ZQ&mode=overlay Я хочу вытащить сам поиск, «соло» кинжала. Я могу grep -o '=*' но это оставляет знак = и все, что следует за поиском. Я хочу захватить все между «search? Q =» и первым «&» в конце последнего […]

Как использовать awk вместе с командой, чтобы показать идентификатор процесса командой «ps»

Я могу показать PID (2-й столбец) командой ниже: ps -ef | grep runner | awk {'print$2'} 2432 6346 6348 6350 6352 7407 7410 7416 10824 17305 17494 29658 Но вместо этого я хочу показать pwdx <PID> а также COMMAND (8-й столбец). Как я могу это сделать?

Объединить поля в файл

У меня есть файл с 7 столбцами, файл GFF с хромосомными областями. Я хочу свернуть строки, где REGION = "exon", только одна строка в файле. Строка должна быть свернута на основе областей, перекрывающихся с каждым Другие. REGION START END SCORE STRAND FRAME ATTRIBUTE exon 26453 26644 . + . Transcript "XM_092971"; Name "XM_092971" exon 26842 […]

Эффективный способ печати строк из массивного файла с помощью awk, sed или что-то еще?

Если бы у меня был файл с открытым текстом, содержащий 8 миллионов строк, и я хочу распечатать на экране строки от 4 000,010 до 4,000,000, что было бы более эффективным: awk или sed? В тексте нет шаблона, и, к сожалению, база данных не является вариантом. Я знаю, что это не идеально, мне просто любопытно, на […]

Linux и Unix - лучшая ОС в мире.